Target Gene Clone Kit-Users need not design primers, prepare templates and optimize PCR operation
Gene is the basis of molecular biology. Plasmid construction always includes primer design, template preparation, PCR amplification, fragment recovery, enzyme digestion and ligation, transformation and the final sequencing. The whole process usually takes two to three weeks to complete.
However, for each specific gene fragment, many factors should be considered such as restriction enzyme sites. Non-specific bands should also be avoided including Hairpin, False priming and Cross Dimer formed by sense/antisense-primer. In addition, annealing temperature and reagent ratio system should be optimized though repeated tests. RNA extraction and reverse transcription of cDNA are needed for the preparation of template. A lot of valuable time is spent on the complex work and the progress of project is greatly hampered.
Cloud-Clone Corp. supplies Target Gene Clone Kit used for preparation and amplification of target gene. The users only need to provide the name of the target gene or sequence. Then we will provide the users with corresponding Target Gene Clone Kit. The users don’t have to spend much time on primer design and synthesis, template preparation, condition optimization for PCR and purchase of appropriate enzymes.Cloud-Clone Corp. also provides the customization service of Target Gene Clone Kit.
Target Gene Clone Kit supplies all reagents for cloning the target gene containing primers, template, PCR Mix and enzyme.
Kit Components:
        Template: cDNA fragment containing target gene
        Primer pairs: PCR primer pairs, 1OD (100 tests, 50ul system each time)
        PCR Mix: Buffer,dNTP,Mg2+
        Enzyme: DNA polymerase, T4 ligase
Example: Human IL-11 Gene Clone Kit
1.Protocol Information
1.1 Information of PCR primer pairs
        IL-11 Hu-sense: ATACGAATTCCCTGGGCCACCACCT
        (25bp, restriction enzyme cutting site: EcoRⅠ)
        IL-11 Hu-antisense:CGCCAAGCTTTCACAGCCGAGTCTT
        (25bp, restriction enzyme cutting site: HindⅢ)
1.2 Annealing temprerature
        557bp PCR product, Annealing temperature: 56
1.3 Optimized system

1.4 Sequence information of the target gene

2. Product Test Report
2.1 Test report for Primer pairs synthesis

2.2 Test report for target sequence amplified by PCR

